EY665176

Overview
NameEY665176
Unique NameEY665176
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length408
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig3799 contig Csv1_Contig3799:1152..1558. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCS00-C1-101-074-H08-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY665176 ID=EY665176|Name=EY665176|organism=Citrus sinensis|type=EST|length=408bp
CCACGCGTCCGGTTTTGAATACGGTTCAGTCGAAGCCAGCAGAAATCTTT
TGCCTTCCTGATTTGAAGATTATGGGAACTCCTTGCGCAGGTTATACCGA
TTGGTCGGAGGGTGGGGCCCCCCCATGGTTTTCACTTATTGCTGATGATG
AAATTAATGGAAATATTGATCTTCTTGTAGTCCCACAATATGGAAGAAAC
CCTGATCACACTGGTTAAGAATATGCAGTATTAGTCTCTTATGTTATGTT
TAAGAAAATAAAAGTATGGGTACTGTTATTACCCGTCAATTGTACGATGG
TCTCAGTTTGGTTCAGTTTAACTTGTAAGATCTCTTGATATATACAAGAG
ATTCTCTTTGTCTAGCTATTTATGTGTACCTTGTTTTCCTAAAAAAAAAA
AAAAAAAA
back to top