EY665175

Overview
NameEY665175
Unique NameEY665175
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length770
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig8002 contig Csv1_Contig8002:1..770. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionCS00-C1-101-074-H06-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY665175 ID=EY665175|Name=EY665175|organism=Citrus sinensis|type=EST|length=770bp
CCACGCGTCCGAGCATGTGTCATACTAATCAATACATAATCAGTGAGGAA
AGATGTCTAAACTCTGTGCAACAGATAGCTATCTTTGAGTTATGTAAAGA
TTTCTTTTTGCTGAGGATCATTTATATCTTATTTACAAAACTTTATTGGC
TATTGAATATTTGTGTTAAGGTAGAAAAACTGATCTGCAATTCTTACTTT
CTTTCGGGATTCTGGCAGGCCTATACATTGGAACTGGAAGCAGAGGTTGC
TAAACTAAAGGAGTTGAACCAAGAGTTGGAGAGGAAACAGGCAGAGAAAA
TAGAAATGGAAAAGAATAAGATTATCGAGAAAATGAAGTACCGATGGGGA
GGCAAAATACTGTGCTTGAGGAGGACACTGACGGGCCCTTGGTAGAGTCA
ACCAGTTGAGCTGCTGATAATAGAAAGTTTGTTTGAAAATGCAATCTTGG
CTGTTGATATGGTACGAGGATTGGTGTGCACATCTTTGATCTATTTCTCA
TACCATGGAGTGTANGCAGCTGCATGTATAGATACCAAGTGTTGTAAATT
ATTAACCGAAATTAGTTTTATACTGTGGACCAAACGTCTAATCTGTAAGA
CTTCTGTTTGCTTCTGGTTTGAACAGAGAAGTATTGTAGGATGGTTAAGC
AGAATGTACGCTTTTTAGTGTGTTTTTACCGGCTACTTGCAGACTTGGTT
AGTCTCTAACCTTCTCTTTGGAGTTGAACTTTTCAATATATAGCATCTAT
TTGCATTTAAAAAAAAAAAA
back to top