EH117789

Overview
NameEH117789
Unique NameEH117789
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length116
Libraries
Library NameType
Different expression profile of FJWC and FJ72-1cdna_library
Properties
Property NameValue
Genbank descriptionfjfw18 Different expression profile of FJWC and FJ72-1 Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EH117789 ID=EH117789|Name=EH117789|organism=Citrus sinensis|type=EST|length=116bp
ATTGATGAGTCCTGAGTAACAATGGAAGCACAAGCCAGCACCGAGCTGCC
ACCCGGATTCAGATTCCACCCAACTGACGAAGAACTAATTGTTCATTACC
TTCGTAACCAAGCCAC
back to top