EH117787

Overview
NameEH117787
Unique NameEH117787
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length293
Libraries
Library NameType
Different expression profile of FJWC and FJ72-1cdna_library
Properties
Property NameValue
Genbank descriptionfjfw40 Different expression profile of FJWC and FJ72-1 Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EH117787 ID=EH117787|Name=EH117787|organism=Citrus sinensis|type=EST|length=293bp
GACGATGAGTCCTGAGTAACAGAGGTATTCTGCTCAGCTTGACTGTACAA
ACTTGATATGAGATCGTTGATAGAAATATTTGAACGAGGACTCTTCTTAG
CACTATCACTAGCAGTAGGAGCAGGATTGGCAGTTAAAGCATCTTGAGAA
ATCAAGGAATTGTCAGTTTCATGTTCCCCATCACCAAAAAGGGACAATGG
CAGGGCTCCCTTGTGGTTTTCCAGCTTCACCTCCTTTCCCATCTTATCCT
TAGATCCAGTTTCTGAAAACGTATCCTTGAATTGGTACGCAGT
back to top