EH117784

Overview
NameEH117784
Unique NameEH117784
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length214
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig7344 contig Csv1_Contig7344:202..415. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Different expression profile of FJWC and FJ72-1cdna_library
Properties
Property NameValue
Genbank descriptionfjfw36 Different expression profile of FJWC and FJ72-1 Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EH117784 ID=EH117784|Name=EH117784|organism=Citrus sinensis|type=EST|length=214bp
GATGAGTCCTGAGTAACTCATTCCTTCGTTGAAGGGTGTGTATCAATCTG
CTGATAACTTCCGCCATCAAAGCCAGCAACTCTGCAGCCTTATCCAGATC
CAACAATAATATTGTTGATAGGGATGAAGATCAACTTGACGAAGAAACCT
ACGAATCCCATGACAACGAATCCGATCGCCGTACGGAACGCAACCTTCTG
AATTGGTACGCAGT
back to top