EH117782

Overview
NameEH117782
Unique NameEH117782
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length289
Libraries
Library NameType
Different expression profile of FJWC and FJ72-1cdna_library
Properties
Property NameValue
Genbank descriptionfjfw13 Different expression profile of FJWC and FJ72-1 Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EH117782 ID=EH117782|Name=EH117782|organism=Citrus sinensis|type=EST|length=289bp
ATTGACTGCGTACCAATTCAGTTACAGGGGAAATGAAGTTGGAAACGACT
ATTGTGCTGGACAGAAAGGAACCTTTGACTCTGCTTTGTAAATCCCTATT
TTGAAGCTATGTTTTGGGAGTCGAGTGTTTCAAAGAATGCCTGTTTTGAT
AGTATTTCATCAACATGTTATAAGCAGTGCAACCCTTTCGTCCTATTATT
GACGAAACTTTTGTTTGTTTATGCTAATTTTGCAAGTCTGAAACATCAAA
CGTCTACTAATACTATGGTTCTCGTTACTCAGGACTCAT
back to top