EH117781

Overview
NameEH117781
Unique NameEH117781
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length289
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig10783 contig Csv1_Contig10783:764..1052. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Different expression profile of FJWC and FJ72-1cdna_library
Properties
Property NameValue
Genbank descriptionfjfw37 Different expression profile of FJWC and FJ72-1 Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EH117781 ID=EH117781|Name=EH117781|organism=Citrus sinensis|type=EST|length=289bp
GACTGCGTACCAATTCAAGCTAGCATTGATCGAAATGTTTTGTGGGGATG
ACAGATTAGTGAAAGTAGAAGTATGATCAGCTGCAAACACTCGATTACCA
GCCGATGTATTTGTGAACGATCCACAGTCTATAAGATAATTATCTACAGG
ATCAAACGCCGTCGAAACAGAAACTAGACAAAGAACTGATGAAAGCCATA
GGAGCAACTCAAAATTCATACATTCACCATCATCAAGACTCAGAAAGAAA
GGATTTGAGGCAAAACTGTGGTTACTCAGGACTCATCGT
back to top