EH117776

Overview
NameEH117776
Unique NameEH117776
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length130
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig8186 contig Csv1_Contig8186:1107..1236. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Different expression profile of FJWC and FJ72-1cdna_library
Properties
Property NameValue
Genbank descriptionfjfw8 Different expression profile of FJWC and FJ72-1 Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EH117776 ID=EH117776|Name=EH117776|organism=Citrus sinensis|type=EST|length=130bp
GACGATGAGTCCTGAGTAACACCACTCAAACAGATACAGATAATGGTGCT
GGAACAGCTGGAGGGACCCTATTTTCAGCTGGGATTTCGACAAACTCTGA
GAGGATTGCCCTGAATTGGTACGCAGTCAA
back to top