EH117773

Overview
NameEH117773
Unique NameEH117773
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length213
Libraries
Library NameType
Different expression profile of FJWC and FJ72-1cdna_library
Properties
Property NameValue
Genbank descriptionfjfw12 Different expression profile of FJWC and FJ72-1 Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EH117773 ID=EH117773|Name=EH117773|organism=Citrus sinensis|type=EST|length=213bp
GATGAGTCCTGAGTAACTCTTGATTCTACTCCAACCAACTGGTTTTTGTA
GTTACATGGAGACATTTCAGCCAGTCTCTTCAAAATGTGATGAACAGCTT
TCCTTATAAGTTCCGATTCAAGCCTAAAGTTCTGAGAATCAAAGCCAGAA
AAACTGGCCGCCTCCTTCAAAGCATTCCTCCAACTCTTCAGCTTCTCTGA
ATTGGTACGCAGT
back to top