EH117769

Overview
NameEH117769
Unique NameEH117769
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length147
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig10927 contig Csv1_Contig10927:440..586. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Different expression profile of FJWC and FJ72-1cdna_library
Properties
Property NameValue
Genbank descriptionfjfw11 Different expression profile of FJWC and FJ72-1 Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EH117769 ID=EH117769|Name=EH117769|organism=Citrus sinensis|type=EST|length=147bp
GACGATGAGTCCTGAGTAACTGTTACTTAGTTGTATTCCATCCTTACCGT
TCACTTGTGCAGTAAGCACTTTTTTTTTGGTTTTTGCAGGACGCTGGCAT
GAATGATATAAATATGACCCATTTATCTTGGTGAATTGGTACGCAGT
back to top