EH117767

Overview
NameEH117767
Unique NameEH117767
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length366
Libraries
Library NameType
Different expression profile of FJWC and FJ72-1cdna_library
Properties
Property NameValue
Genbank descriptionfjfw41 Different expression profile of FJWC and FJ72-1 Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EH117767 ID=EH117767|Name=EH117767|organism=Citrus sinensis|type=EST|length=366bp
GACGATGAGTCCTGAGTAACTGAAACCCCTGTTCATATCCTGGACTTCAA
AGCGGCAGCCATTGAAAAATTTTGAAGGAGATAAGAATTTTCCCTTTTTA
CTTTTCACTAATACAAGTATCTAACAGACTCTTACAATGACCAAAAGGCT
CCTTCAATCTCAAGATAAATAAAGATTACAACAATATGAGACCCCAAGCA
ACCATTATACCAAACTTACCAACCAAACCTGCAGCAATTCACTTCCTTTG
CTTATTTCCCAAATCTACACCGCAAATGGACCATATGTCTATATTTACCC
ACTGGGACCAGCTCCAGAAGGGAGACTCTTGACTTTGTTATCCCTTCTTC
TGAATTGGTACGCAGT
back to top