EY664760

Overview
NameEY664760
Unique NameEY664760
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length822
Properties
Property NameValue
Genbank descriptionCS00-C1-101-070-B05-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY664760 ID=EY664760; Name=EY664760; organism=Citrus sinensis; type=EST; length=822bp
AGCAATTTTAGTCTATCATAATATTAAAAATTCTATTAATAAAATTTGTT
AAAATTTTACTTTTACATAAAAATTTAATTATATATTATAAAATTAATTT
AACTAAATTTTGTATTTAAACATAAATTACTCATATGATTAAATCATTAT
ACTATTAAAAATAAAATATAAATAACTAGGCAACAAGAATTTTCAACTGT
TTATCAAAAACATAGTTTAAAGATTAGATTTTAAATAAATTCTGCTCAAT
GAAAATTTAATTAAATAGCTGCGGTTTATACTGTACTAAGGTAGCATAAT
AATTTGTTTTTTAATTAAAAACTTGAATGAAAGGTAACATGAAAAATTAA
CTATTTAACATGTTTAAAAGTAAAATTTAATAATTAAGTAAAAAATCTTA
AATAAAATAAAAAGACAAAAAGACCCTTTAGAATTTTATAATTATTTTAA
ATAAATTTAACACTAATTATTTAGTTGGGGAGACTATAAATAAGAATTAA
CATTTATTTTTCAAAAATACTTATAAGTAAAAACTAAAATAACCAGCACT
AAGCTGAAAAAAAAATAAATTACCTAAGGGATAACAGCGTAAAATTTTTA
GAAAGATCAAATTTATAAAATTTATTACGACCTCGATGTTGGATTAAGCA
ATTAAATAAAGAAAGATTTATTAATAAATTANGTCTGTTCGACCCACCAA
GCTTACATGATCTGAGTTCAGACCGGCGTAAGCCAGGTCAGNTTATATCT
TTTATATATAAATTTTATNATAGNACGAAAGGATTTAATTAAATAAATAA
TTATAAAAAAAAAAAAAAAAAA
back to top