EY664754

Overview
NameEY664754
Unique NameEY664754
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length901
Properties
Property NameValue
Genbank descriptionCS00-C1-101-070-A11-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY664754 ID=EY664754; Name=EY664754; organism=Citrus sinensis; type=EST; length=901bp
GTACCATTTTTTCTCCCTCTTCTGTCTCGTCACTCAGATTGAGATTGAGA
TAGAGACAGAGGAGGTCTCTCAGCTGAAGCTATCCGTACGGTACAGGGAC
TGTGTTAGGCATTTTATTTTAAACTGTATTTGAAGTATTCTTCGAACATC
ATAGATCCAATGCCAGCCCTTAAAATGAAAGCTAAAGCAAGTGCGACTTG
CATTAGGGAAGTAAGTTGTCTGCATGTTACTCAGAAGTCAAGGAAGATAT
CAAAGGATTCATGTTCCCTTGTGCGGTTGTGTTGTGAAACAGCAGAATTG
GATACATCAGTTCAGAATTGTAATAATGACTCTAGCAAAGTTGTATTGTC
TGCAACAGAAAATGGACATAATGAAGCCAGTCACTGTAAAACATGGTATG
ATGGAGAATATCCTGCATTTCAAAAATGGTTTTCATCTGCTGAAGATCCT
GTACTTGTTAGAAAAATGGATTCTCCACCTCCTGCATGTCCCACAAATTT
TGAAGCAATAACTTCTCATGTCACAGATGGCAATGGCATTCATTTCGAAT
CAATTGCTCAAGATGATGAANGATATGAGGGTGGTCCTGCTGTTCCAGAT
ATGAAAGCTGATGACTATGATAATTGGATCAGTTATGTTGGGCAAAATCT
GATGCTTGATATGACTGAGGAATCTATGAAGTTGCCTGCCCTTAAGGAAA
AAGCAGAGATGGTGGATATGAATTCTGCTGGATTATGTCAAGAGCTTACC
AAAAATTCTGATTATTCAGAGTCTTTTCTAGTGAGCCACTATGATCANGA
AGTTGATGTTAACTCTGGCAATGTTTGATTAGATGAAGTAGATTTTGATC
CGCAGNTGTTCATTAGAAATTTTTGGNACCTATCCGACATGGATNCCGAT
C
back to top