EY664753

Overview
NameEY664753
Unique NameEY664753
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length330
Properties
Property NameValue
Genbank descriptionCS00-C1-101-070-A10-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY664753 ID=EY664753; Name=EY664753; organism=Citrus sinensis; type=EST; length=330bp
TCCACGACAGACCCACGCGTCCGTCTAGTAATAGNAACAGATTTGTCTTG
AGCAAAACCTATTACTTATTTATACACATTGCATGAAAATAGGATATGAA
TAATGAATATGTTTTTGCTCAAGACAAATCTGTTGCTATATCTTGAAATT
CTCGTGGGATGTTGAGGGAAGTATGGGCGGTTTTTTTTTGAGATCTAAAC
TGCTTGCTGTGGGATGCGGTTTTGATTTGAGTGAAGGGCTGTGCTAGTAC
CTGCTATGAACATAGGTATTGCCAGGATCGCTTTGGTGGCGGCAAAAAAA
CGAAACCAAGATAACAAACAAAAAACAGGG
back to top