EY664752

Overview
NameEY664752
Unique NameEY664752
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length262
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig11761 contig Csv1_Contig11761:1235..1496. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCS00-C1-101-070-A09-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY664752 ID=EY664752; Name=EY664752; organism=Citrus sinensis; type=EST; length=262bp
GAGTTTTGAAGACTAATAAAGACTTCATTGCACTACCATGAATAACAGGT
AGGTCAAAAGTTGGCTTGCTTATGCACGTCTCGTCGATCAACTATTAGAA
GAAATTAGAAGGTCCCTAAAATTAATATTGTTTATTGTAGTGTATCAAAA
GTATTGGCTTATGGAATGTATTATGTTATGTTGAATACATTTTTTGGCAC
AAAGTCAAATGAAGTATAATTATTTTTGCTATTATCATAAAAAAAAAAAA
AAAAAAAAAAAA
back to top