EY664705

Overview
NameEY664705
Unique NameEY664705
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length355
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig5882 contig Csv1_Contig5882:742..1096. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCS00-C1-101-069-E05-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY664705 ID=EY664705; Name=EY664705; organism=Citrus sinensis; type=EST; length=355bp
CCCGACCCACGCGTCCGGAAGGCGAATAGATCGGACTTTGTTCAAGGGTT
GTTGTTGTCCACCATTCTTGATGATATTTTATGAAGATAATTCAAGGCAG
CTGCTGCATCAGTGGACTTCAAAGTTAAAACCAAAGCTGTGCAATCTATG
GTTTGCTTGTAGTTATGCCAATGTATTGAACAGTGTGTCGAATAAGGTGT
AGTATGAGTGTAATTTATGTTGCAAGAGTACTTTCTTTAGGCTTAGAACA
GACTTTCGTGTTACCTTTCAATCTTCAGATCATAAGTTGATGATGAAGAT
AAAAAAAATGAAAATAATTTCTGTTCTTCTTTAAAAAAAAAAAAAAAAAA
AAAAA
back to top