EY664686

Overview
NameEY664686
Unique NameEY664686
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length823
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig7237 contig Csv1_Contig7237:345..1160. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCS00-C1-101-069-C08-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY664686 ID=EY664686; Name=EY664686; organism=Citrus sinensis; type=EST; length=823bp
CAATTTGGGCATTATGCTAGGTAACATATGTCTGAGACTTCAAAATGCAC
TTTGTGTTGAAGAAACTTGTCAATTATTGAGGGAGAGCAAGTTGCAAAGC
TTGGTACTACGGTGGATCAGATTCGAAGAACATGTTCAAGCATTATGTAA
ACTTCTAATTCAAAACAGTGAAACGCTGGCATCACTTGAATTTCTTCACT
GCAAGCTCTCTCCAAGTTTTGTCGAGGGAATTTGTCGTTCTCTTTGCAGT
AAGAGAAAGCGAATACACAAGATTGAAAACTTATCAATCGACATATCAAG
CTTTATCGAAAACTGCCCAAGTTCTGTAGTTGTGGAACTTGTTTCATTTC
TGTCATCCGGGAGGTCATTGTGTTCATTAAAGCTTCGTCATTGCCATCTG
GACAGAGACTTTGGAAGAATGGTTTTTAGTAGCCTTCTTGAGGCATCATC
TAGTTTATCCATCCTTGACCTTTCAGGAAACAGTATAGGAGGATGGCTTT
CTAAGTATGACAGAAGTGGCCCCCTATTTTCTTTANGAGCTGGNCAGTCT
TTGCAATCCTTACGTTTGCTCAATCTAAGGGGAAATAATCTCTGCAAAGC
TGATGCTAGAGATCTTGGATCTGCACTGGTTCATATTCCTAACTTGGAGA
TCTTAGATATAAGTGACCATACTATTGAGGACGATGGAATCAGAAGTTTA
ATTCCCTACTTTGTACAAGCATCTGAACGGGTGCATCCCTTGGTTGGATT
GTATTTGGGAAACTGTGAGCTTTCCGGTCGTGGAGTCTCTCACTTTCTGA
ACGCTGTCGACCTTAAGAGACCA
back to top