CX043369

Overview
NameCX043369
Unique NameCX043369
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length759
Properties
Property NameValue
Genbank descriptionUCRCS07_10F03_g Parent Washington Navel Orange Thrip-Challenged Flavedo cDNA Library UCRCS07 Citrus sinensis cDNA clone UCRCS07-10F03-L6-1-6.g, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX043369 ID=CX043369; Name=CX043369; organism=Citrus sinensis; type=EST; length=759bp
CCAATCCCCGGCTGCTGCACCAACAACAGCTCCTGCAAAGGGTAGCAGCC
CAGCAAAAGCTCCATCCACAGCTCCTGCAAAGGGTGGCAGCCCAGCAAAA
GCCCCATCCACAGCTCCAGTGAAAGCCCCCGCTAAGCCCAAATCACCAGC
TCCCGCCGCTGTTCCAGCAGCTGCTCCCCCATCTACAACCCCTGCAAAGG
GTGGCAGCCCAGCAAAAGCCCCATCTACAGCTCCAGTGAAAGCTCCCGCT
AAGCCCAAATCACCAGCTCCCGCCGCTGTTCCAGCAGCTGCTCCGTCTAA
ACAGGCTGTCCCCGCTCCGGCAGCAGCTCCCACATCGACTCCTCCGGCGG
CTACTCCAGTGAGTTCGCCTCCAGCTCCGGTTCCAGAAGCGAAATCACCT
CCAGCACCTACTCCTAAAGCTGCGCCGGAGACTTCACCAGCGGCTCCATT
GGCTTCGCCCCCGAAAGCCGAGGTGCCTGCGCCGGCTCACAGCAAGAAGA
AGTCAAAGAAGCACCATGCCCCAGCTCCTTCCCCGGCTTTGTTGGGCCCG
CCAGCACCACCGTCGGAGGCTCCGGGACCGAGCGCCGACTCAATGTCTCC
CGGTCCATCTGTCGCCGACGACGAGAGCGGCGCAGAAACGATCCAGAGTG
TGCAGAAGATGATGGGCGGGTTGGCATTGGGATGGGGTCTGCTAGCTTTG
ATCATCTAGAGAGAGATGTTACCGTCGTTATTATTTTGATCTTCTTTGTT
CATTTTTTA
back to top