CX043368

Overview
NameCX043368
Unique NameCX043368
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length733
Properties
Property NameValue
Genbank descriptionUCRCS07_10F03_b Parent Washington Navel Orange Thrip-Challenged Flavedo cDNA Library UCRCS07 Citrus sinensis cDNA clone UCRCS07-10F03-L6-1-7.b, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX043368 ID=CX043368; Name=CX043368; organism=Citrus sinensis; type=EST; length=733bp
GCAAATTAAAAAAATATATATATCAAATGTGTAATAACAGAGTGAACATG
AGGGGTAAAAAATGAACAAAGAAGATCAAAATAATAACGACGGTAACATC
TCTCTCTAGATGATCAAAGCTAGCAGACCCCATCCCAATGCCAACCCGCC
CATCATCTTCTGCACACTCTGGATCGTTTCTGCGCCGCTCTCGTCGTCGG
CGACAGATGGACCGGGAGACATTGAGTCGGCGCTCGGTCCCGGAGCCTCC
GACGGTGGTGCTGGCGGGCCCAACAAAGCCGGGGAAGGAGCTGGGGCATG
GTGCTTCTTTGACTTCTTCTTGCTGTGAGCCGGCGCAGGCACCTCGGCTT
TCGGGGGCGAAGCCAATGGAGCCGCTGGTGAAGTCTCCGGCGCAGCTTTA
GGAGTAGGTGCTGGAGGTGATTTCGCTTCTGGAACCGGAGCTGGAGGCGA
ACTCACTGGAGTAGCCGCCGGAGGAGTCGATGTGGGAGCTGCTGCCGGAG
CGGGGACAGCCTGTTTAGACGGAGCAGCTGCTGGAACAGCGGCGGGAGCT
GGTGATTTGGGCTTAGCGGGAGCTTTCACTGGAGCTGTAGATGGGGCTTT
TGCTGGGCTGCCACCCTTTGCAGGGGTTGTAGATGGGGGAGCAGCTGCTG
GAACAGCGGCGGGAGCTGGTGATTTGGGCTTAGCGGGGGCTTTCACTGGA
GCTGTGGATGGGGGCTTTGCTGGGCTGCCACCC
back to top