CX671825

Overview
NameCX671825
Unique NameCX671825
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length868
Alignments
Feature NameTypeLocationAnalysis
CX671825_ssr32 microsatellite CX671825_ssr32:32..67.
Csv1_Contig1576 contig Csv1_Contig1576:169..1036. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionUCRCS10_13D04_b Madame Vinous Sweet Orange Multiple Pathogen-Infected cDNA Library UCRCS10 Citrus sinensis cDNA clone UCRCS10-13D04-G7-6.b, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX671825 ID=CX671825|Name=CX671825|organism=Citrus sinensis|type=EST|length=868bp
TTTTTTTTTTTTTTTTTGAAAATTATTCAAATATTATTATTATTATTATT
ATTATTATTATTATTATTACTCAAATCCTAGAGATAATTAAATTCACACA
TGTAATGACTTGACTCTCATCACACCATCCATCAAACTCTTAAGCAGCGA
AACGACCCTCTTTGGAACCCACAACTGCAACCCCGACGTGACGTAAGCGG
AAAGCATTCCTCAATAATCCATCAATCATGCACCTCTTCAGCATGAATTG
GATAGTAGCAAGCCGCGTACGTACAGGGTGCGTTGATGTATTGTGTGTGG
ATCGAATCGCTTGGCATAATCCTATGCTCCATATTCAAACCTCAGATCAC
AACCCTTAATTAAAAACTTAATAATAGTAATAATAACAAGACTGACTTAG
AACAAAAAATTATGTAAAAAGTAAATAAAACTTGGCCGACTTTTGATAGG
GCTCTATTCCTCAGTCAGTCTTGCCGACTGGAACTCCTGTGGAAGCTGCT
TCTTCAGGTGCTTTAGCTGGCTTCTCCTCTTCAGCTGGTTTCTCTTCCTG
GACCGGAGCTGCCTCAGCCTCAGCCTCAGCCTCAGCCTTAGGGGCCTCTT
CTTTGGTTTCCTCAACGGTAACAGGCTCTTGGTCGGGTTTCACTACTTGT
TCTGCTTTCTCTTCCACTGCAGCATTAGCTGCCTCATCAACCTTAGCTTC
TTCTACAACTTGCTTGGTTTCAACTTCAACTGGGGTCTCAGCGGCTGGTT
CCTCAGCAGCTGGACCCTCATCTGGGGCCGTTGCTTCTTCCTTTGGTTCT
TTGGTTGCGGTCTCAGCTTCGGTGGCAGCTGCCACTGGCGCCTCTTCCCG
GGTTGTCTCGTTACTACT
back to top