CX671268

Overview
NameCX671268
Unique NameCX671268
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length619
Alignments
Feature NameTypeLocationAnalysis
CX671268_ssr440 microsatellite CX671268_ssr440:440..451.
Csv1_Contig2790 contig Csv1_Contig2790:62..680. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionUCRCS10_10A06_g Madame Vinous Sweet Orange Multiple Pathogen-Infected cDNA Library UCRCS10 Citrus sinensis cDNA clone UCRCS10-10A06-A12-5.g, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX671268 ID=CX671268|Name=CX671268|organism=Citrus sinensis|type=EST|length=619bp
GTTTTCTCAAGCAAGAAAAAGAAAAATGGGTTCCAAATTGTTCCTTCTTT
TAGGCCTTTTAATGGCCATTGCTCTTCTTATCTCTTCCGAGGTAGCAGCC
AGAGACCTGGCCGAGACTTCCATTGATCACAACGAAAAGGCTGATAAGGC
CACAGAGACACATGAAATTGAGGACGGCCGTGGAGGTTATAACCGCGGTG
GCCGTGGAGGTTATAACGGCGGTGGCCGTGGTGGCTATGGAGGTGGTGGG
GGCTATGGCGGTGGTGGGGGCTATGGCGGTGGTGGGGGCCATGGCGGTGG
CCACTGCCGCTACGGTTGCTGTGGACATGGTTATCATGGAGGCTGCAGGT
GCTGCACTTACGCTGGTGAGGCTGTTGATACGGAGCCTGAAACCGAGCCT
CAAAACTGAAGCTCCATAATAAATTTGTATCTGTATCTCAATAAATAAAT
AATCTTGCTTACATTTATGCGATGTAAGCTTCATTCTGTTTTTCCTTTTT
TCTTTGTTTTGTAAGTGCAATGTAAGCTGCTTGTTCACAAAAAAAATACT
TCTTTTATATAAAAGAAGTATTTATGAATAAATGAGTACATTTTTAGAGC
TTTAAAAAAAAAAAAAAAA
back to top