EY692330

Overview
NameEY692330
Unique NameEY692330
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length691
Libraries
Library NameType
Sweet orange bark, greenhouse plantcdna_library
Properties
Property NameValue
Genbank descriptionCS00-C2-003-059-B11-CT.F Sweet orange bark, greenhouse plant Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY692330 ID=EY692330; Name=EY692330; organism=Citrus sinensis; type=EST; length=691bp
ACCAGAGTAACAATCTNTGGCTACCCTTGGAGAGGTCAAGATCCAACTAC
AAGGGTTCTTAGCAGTCACTATTTAAACCTTGCGTCAGGATGTCAACTGC
AGATAATTAAGTAGAATGTTTGACAGTAAATGGAAGTCAAAAGGGAATCA
GGGCTTGCATCATTTTCACTTCTTAGAGCACTAGCGTACAGTAACTATTT
GCAAGTTTACAGTAACTATTTGCAAGTTTAAGGCTGCAATCAATGAGCAG
ATCAAGTGGCTTCAGTCTATCGTATGTTGCTGTCTCTTTGAAATTCTTTT
TTTTATATCATTTTATCTTCTTTTTGTCTTTATATCAGTTGAGTTATTAC
TTGTCTTTCTGGATTTGTGTTATAGTGGGGAATTCAACGTGCTCTATGTA
CCGCACCATGTATGCATATAATGCTTAGGACAATTTTGCTCTCAGCAACC
CTGCCTAGCAATTGCTTTGTCACTACTTTGATTGCATCAAGCGATGAATA
ATGTCGTAATCAGAATTTTCAAGGGGGAATTTGGCAATATTGGCCCCTTT
AGAGTTTGAAAAACCAAAGAACGGAGGCTCCTTATATTGTACGGTACCAT
GGTATGCTCCGTATGCCTTTTCTCATGAAAAAGTGGCAGAATTCTCATCC
AATTTAATTTCTTTTTTATTTTGGGCCAAAAAAAAAAAAAA
back to top