EY659943

Overview
NameEY659943
Unique NameEY659943
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length653
Alignments
Feature NameTypeLocationAnalysis
EY659943_ssr458 microsatellite EY659943_ssr458:458..469.
Csv1_Contig2790 contig Csv1_Contig2790:44..695. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionCS00-C1-101-016-G10-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY659943 ID=EY659943|Name=EY659943|organism=Citrus sinensis|type=EST|length=653bp
TCAGAGGCGCGTNCGGATAGTTTTTTACGAAAGAAGGAGAAAAATGGGTT
CCAAATTGTTCCTTCTTTTAGGCCTTTTATTGGCCCTTGCTCTTCTTATC
TCTTCCGAGGTAGCAGCCAGAGACCTGGCCGAGACTTCCATTGATCACAA
CGAAAAGGCTGATAAGGCCACAGAGACACATGAAATTGAGGACGGCCGTG
GAGGTTATAACCGCGGTGGCCGTGGAGGTTATAACGGCGGTGGCCGTGGT
GGCTATGGAGGTGGTGGGGGCTATGGCGGTGGTGGGGGCTATGGCGGTGG
TGGGGGCCATGGCGGTGGCCACTGCCGCTACGGCTGCTGTGGACATGGTT
ATCATGGAGGCTGCAGGTGCTGCACTTACGCTGGTGAGGCTGTTGATACG
GAGCCTGAAACCGAGCCTCAAAACTGAAGCTCCATAATAAATTTGTATCT
GTATCTCAATAAATAAATAATCTTGCTTACATTTATGCGATGTAAGCTTC
ATTCTGTTTTTCCTTTTTTCTTTGTTTTGTAAGTGCAATGTAAGCTGCTT
GTTCACAAAAAAAAATACTTCTTTTATATAAAAGAAGTATTTATGAATAA
ATGAGTACATTTTTAGAGCTTTAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAA
back to top