DY257115

Overview
NameDY257115
Unique NameDY257115
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length586
Libraries
Library NameType
AbsCFruitcdna_library
Properties
Property NameValue
Genbank descriptionKN0AAK1AC12FM2 AbsCFruit Citrus sinensis cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY257115 ID=DY257115; Name=DY257115; organism=Citrus sinensis; type=EST; length=586bp
CAATAATGACTCGAATTCCTCCCTAAAAACGTTAACGAGGCACCTCTGCC
CCATTGTCCCAAAATCAATCAATCTATCTTGTCCCAGCTGCAACTCACTA
CCCCCACATGCTAAAACTCATTTTTACCTCATTTTATTCTTTATTTTTTT
CACTTTCTGCTGCGTCTTCTCCTGTTCTGCCGACATGTACGTACATTGTC
GCCTACAGCAAATCCCCAACCACTCTTACACTCTTAATAAAAAAATACGG
ATAACTTCACCCTTATGCATTTCTCTCATACCTAACCAAATATCATTAAC
TCCCCCCCTCTCATCCCAAACTACTAAAAAAACAGTTATCCCCTCCCCTC
TACCTCCTACTATAGTAGCCAAATCGGCACGACTTGCACATAATTATACC
CTCCTGCCCTTCTCATCTCACTCCTATTCCATTTTTAACTCCTCATAACT
AGTTTACTCGCCGTCTTGCCCCTTCACCCTCTTACCTCTTCTCCTGTATA
TCTTATCACACCACTGTCTCTCTTCTCCCTCTCTCCTCCTCACCATTACA
CTTCACGAATACTCCATGTCTTCATCCTTTATCATC
back to top