DY257112

Overview
NameDY257112
Unique NameDY257112
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length241
Libraries
Library NameType
AbsCFruitcdna_library
Properties
Property NameValue
Genbank descriptionKN0AAK1AC09FM2 AbsCFruit Citrus sinensis cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY257112 ID=DY257112; Name=DY257112; organism=Citrus sinensis; type=EST; length=241bp
GGATTGATCGCAAGGAGTACATGGGATTCGACAGCATTTGTTCGTATACA
TGAAGGTCACAAAAATTGAAGGACTAACATCTAGGGATGAAATATTGGAT
TCAAATATATATCACTTGTTCTGACTAGTTATAAGTAATTTCTTGGTTAA
AAAAAGGATTGTATAATTGTAATTTATCTATTGATTCATTACCTATTTAA
ATGAACGAAAAAGGGAAAGAAGAAAGAATCACATTAGCTAG
back to top