DY257111

Overview
NameDY257111
Unique NameDY257111
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length747
Libraries
Library NameType
AbsCFruitcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionKN0AAK1AC08FM2 AbsCFruit Citrus sinensis cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY257111 ID=DY257111; Name=DY257111; organism=Citrus sinensis; type=EST; length=747bp
ACTTTGTCATTTGAGTCAACATGAAGAAAGCACACAAACAAAAAAAAAGC
ATTCAGCCTTGAACATGGGACAGCCCCTTCTACTTTCCACGACAATGATG
TCATTCAACGCTACTCAACTGTTCAATCAACTCATCACCTATTTATAAAT
CAAACAATAATGCTTATGACACCAACACCATTGCAGTCCCTTTATGTGAC
AAGAAAGGTGCATCCATATGCAGCTTTTTGTATTCATGCAGAGCAATTAG
TATGTTGAACCTCCCGATTTCTACGTGCTGTGTTTACACTCCCGTGGATC
TAGGGCCATCGTTTGAGATGGATTTGCAGAAGCTGCAATGCTCCTCGTAC
TCTGCGTTCTATAGCTTCGATGGGCAGGATTATAATCCTGAAAATTGGAA
GTATGGGATAGCGCTTAAATACAAGTTTAATGTGTATAACGACTATCCAG
GCTCCTGTGCCCACTGTGAGGAGAGCAACGGAGCTTGTGGGTATTCAGCT
GTAGCTTACAATTCCTTTATTTGTAACTGTCCCAGTGGAATCAACACAAC
AACAGATTGTTACTTTGAAGCAGCTTTCAATAATGCTCTCCCACGGCAGA
CGGTGACATGGTCGGTCTATCCGTTGGCTTCGATTCCGGCTTTGTTCTTG
TTCTTGTTGTAGATTGTAATTTGCGACAGACGGCAAAGGTAAAAATTACA
TAATGGAAGAACCGTATTAAAAATGTTCCAAAGTTTTTAGTTTATTT
back to top