DY257107

Overview
NameDY257107
Unique NameDY257107
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length233
Libraries
Library NameType
AbsCFruitcdna_library
Properties
Property NameValue
Genbank descriptionKN0AAK1AC03FM2 AbsCFruit Citrus sinensis cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY257107 ID=DY257107; Name=DY257107; organism=Citrus sinensis; type=EST; length=233bp
GCTGCTCTTGGCATGTCCGACATTTCTGGGCTTGTTGAAGTTGAGCCACA
GAGCATGATTACTCCTCCAGTTTTTGGTCGGGGTGGTGGCAGGAGGTACT
GAGTTAATTGAGGCTTTGTGGCTCAATCAAGAATGAGAAGTTTAGGTTCT
TATTAATCAGTACTTCTTGTGTTTGTTATGAATGCTTTTGTGACTAGTTT
TCTTTACTATTTTAAGAAGGGTGTTTAGTTAAA
back to top