DY257101

Overview
NameDY257101
Unique NameDY257101
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length1334
Libraries
Library NameType
AbsCFruitcdna_library
Properties
Property NameValue
Genbank descriptionKN0AAK1AB04FM2 AbsCFruit Citrus sinensis cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY257101 ID=DY257101; Name=DY257101; organism=Citrus sinensis; type=EST; length=1334bp
CGAAAATATTCATAGTGAATTTTCATGCCTGGTTAGTTTTTTTCTGTCTG
CTTGCCCTGTAGCTGGATCCTGTGAACCATCAGGATTGGATGTGCTGAGT
AATGGTAACATTCCTTTGTTACAAAGCTATCAAATTGATCGTCTGAAAAC
TAAAAAAAAAACAGAAATGAAATAAAAAAAAACCGAATGAATGACATGAA
AATACAAGCATGAAGAAAAAAAAAGAAACTGCCCCTCGTTTCCCCACCTG
ATCTTGTGTTAACAAAAATTGTTGGTATTCACTTTTGGGCAAAAACGGGC
CCCATAAAATAAAAAAAAGCACGTGTGCCTCACTACTGCGGGGGTTACCA
ATAATGTAAGGGTGATTAAAGACAAATATAATTTCTCTACTTCGTTTCTA
TGATGGTCTAATACCACTGTGTGGAGTGATGAGCTTGAAACGACACCCAT
CACCTCAAAAAAGCTCGCAGATCCTACTCCGGAATCATGTTATTTATCGT
CACGACCATTGCAGCACCGAACTTTTTAGAACACACCTTTTTCGAAGAAA
AAAAAATAAGCCCCCCAACAGGCCACACCCTGTAACCCCGATTGCCCTTT
CTATTAAAGAATGCTCTACCACGCCCAACTCTAAAAAATCATTAATTTCC
CCCACCTCCCAACTTAGTTCCCCCCCGCAGAAAAAAAACCTCAAAATCTA
GCCGCTCCCCGGGACCCTTGGCAGCACATCCTGTGACTTTTTTTCCTAAA
AACTTGAACAAGGCTAGCAGCTCTCCCCCCCCAACAAAAACACATTCACA
CATCTCCACCCCGATTCCTCTTCTTGGGTGCACCCAGTCCCAGCCAACAA
CCCACAGACCTCGCCAAAAAGGAAAAAAAACAAAAAAAAAATCCCCACCA
ACACAATACCTAAATCCCGTCGGGGCCGCCCCACACATCCTTTCCCCCAA
AAATAGAGTTCTCCTTAAAACCCCCAAAGTCCCGTTTTTCCAGGATGGTC
CCGAGCGGAATATAACACCGGGAACTTCCTCACACTTAAACTCGCATATG
TCCGCTAATCCCCGCCTTATGAACGAAGTCGAGCCTCACCACCCCCACCA
CCCCCTCCCCCCTCCTCTCACTTCTTCATGTATACTCTCGCCCACACCCT
CACCAAGCTCACCATTCTAAAAAAAATAATACCTCCTGCTGACACTCATT
CTGCTCACTACTTCCCCCTCCTCTATTGCGTTTTCTGGTGAGTGCCCCCC
CTCCCCGCTTTACTTCTTTCTTACGGCCTCCCCTGTTTTCGCCCCGTCCA
CACCAACCATCCCTCGCACCTCAAACACCTCGCA
back to top