DY257099

Overview
NameDY257099
Unique NameDY257099
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length351
Libraries
Library NameType
AbsCFruitcdna_library
Properties
Property NameValue
Genbank descriptionKN0AAK1AB01FM2 AbsCFruit Citrus sinensis cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY257099 ID=DY257099; Name=DY257099; organism=Citrus sinensis; type=EST; length=351bp
ACCCACCAACAAGAATCACTCTCAGAACCGCTGGGGAACACTACTTCTTT
TGCACTGTCCCCGGCCACTGCTCTGCGGGCCAAAAGCTCGCCGTTAACGT
CACCGGAGGCAGCAGCACTGCGCCCAGTGCCTCGCCGCCATCACCCACAG
CCACTCCTCCTTCTACTACAACCAATCCTCCACCACAATCTCCGGGAGGC
GGTACCGCACCTCCTCCGCCTAATAGTTCCGCTAAGTCTCTAGGCGCTGC
TAGCTTATTTACGAGTTTCCTTGTTATTGTTGCGGGTTTATTGTATTAGA
CATGGCGGTATAGAGTTAGTGAGACTTTTGAGACATGATTCATTTTTGTG
T
back to top