DY257098

Overview
NameDY257098
Unique NameDY257098
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length153
Libraries
Library NameType
AbsCFruitcdna_library
Properties
Property NameValue
Genbank descriptionKN0AAK1AA12FM2 AbsCFruit Citrus sinensis cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY257098 ID=DY257098; Name=DY257098; organism=Citrus sinensis; type=EST; length=153bp
CGGTTACTCAGTACCTTCAATTTCTGCGGATTTTATTTTTCTTCATTCCC
AGATCATGACTATATTTTCCGGAAAGGTTAAATGTTGTACTTGGATTGGA
GATTTGTAAGAGATATCCTAAAATGTTGGGAGAATTTTGTTTGCAAAAAA
AAA
back to top