DT214586

Overview
NameDT214586
Unique NameDT214586
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length877
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig10442 contig Csv1_Contig10442:42..918. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS11_02P23_f2 Parent Washington Navel Orange Red Scale-Infested Rind cDNA Library UCRCS11-2 Citrus sinensis cDNA clone CS_WEd0002c_H12_VN, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DT214586 ID=DT214586|Name=DT214586|organism=Citrus sinensis|type=EST|length=877bp
ATGTATTACTTTACACAAGTGATCACGAGGAATGAATTAAGGGCAGTACA
CTTTACATTTTAACATATTACCACTTATCTTTCATTCATAACATGCCATA
AAATCGCACATGTACAAAATTTAGTGTATGATACCACTCAAATCTTCTTC
CCCTCTTCTTGAATTGGTCTTGACCTTGCTTCACGAGTAATGAATATGTG
AACCACCAATTCATCGGAAACTAATATCCCAAAAGGGCTGGATCTTGTTT
CTCTTGCGCCTGGTATTTTATGATTTGTTAGACTGGATTAGAGTTCTCTG
CGGCAACCCGAACACGCCAGGTAAAATATTGAATATACAATGAGTTGAGG
CTCATTGCAGCTCCAAAACCCAAAAGTGATGAAAGCAATATTGCATAAAT
GGCCTTCAGATGAAGAATGGTATAGAGTAAATGAACAGCAACGGCCACAA
GGGCAAACTCAAGAGCCGCATAGGTCCATATATACTCCCTGATTGCTAAA
ATCACCGCGAAGATAGAGGATAAAATGCCCAATGTAAATGCAAATGGCGC
TGCAAGTACAATTGCTTGGGTCTTCAAGTCATGAATCAATATCTGCTCGA
GGAAGAAGAAGTAACATATTGTGCTAATTAGGACAAGCACCACAAAATCC
TGCCAGGCACTTACTGATCGAGAATGCATAGTCTGTTGACTGTGATTACG
TCTATTGTCCCTTTGAGCAGAGCTTGACATCCGTAGCAAAGTTACCGGCA
AGTTTTGAACCTCTTTCCCACACACTTCGCAATTTTTGTTGCCTTTCGTG
AAAAACCACCTGATTGCACATTCTTCGTGTACAAGTCTAAGGGCACCTTT
GCAACTGCATTCCATTTTGAGTGTATT
back to top