DT214553

Overview
NameDT214553
Unique NameDT214553
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length272
Properties
Property NameValue
Genbank descriptionUCRCS10_12B03_b2 Madame Vinous Sweet Orange Multiple Pathogen-Infected cDNA Library UCRCS10-2 Citrus sinensis cDNA clone UCRCS10-12B03-D6-6.d-polyt, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DT214553 ID=DT214553|Name=DT214553|organism=Citrus sinensis|type=EST|length=272bp
TTTGTAATAGAGTAATGATCTAGTGGTGTCGTTGCTCGTAAATTTTCGAC
CATTATGGCTCTACTGTGAGCAAAGTTTCTAACTGGATTATTACTTTTTT
CTTTTTTTGTTCATATATCCCCCTGTTCTTTTAACAAATTTTTCCCCTGT
TAAGATGGTTGTCTGGGTTAACCAATAGCTTCGCTTTCGTTCTTACTGTT
TGCCGCCATGTCATGTACAGTAATAATAAGATATGGAATGAAAAGTTTTG
TTTAATAAAAAAAAAAAAAAAA
back to top