DT214550

Overview
NameDT214550
Unique NameDT214550
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length819
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig4247 contig Csv1_Contig4247:712..1530. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Ruby Orange Developing Seed cDNA Library UCRCS09-2cdna_library
Properties
Property NameValue
Genbank descriptionUCRCS09_8A04_b2 Ruby Orange Developing Seed cDNA Library UCRCS09-2 Citrus sinensis cDNA clone UCRCS09-8A04-A7-1-4.d-polyt, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DT214550 ID=DT214550|Name=DT214550|organism=Citrus sinensis|type=EST|length=819bp
CAATCATCATCCAAATAAGAAAGCCCAAGCAACAGAAAAAAGCCAACCCA
TTTAGGGTAAAGGTCACATAATACAGCTACAAGTCATCCTTTGTATCAAC
GTGTTAATTGTTAATTTGTTATGCCGCTAAAATTGTCTGCTAAAATTGTC
TTATTACTCCCAACACCATTTCTGGCAGCATAAAAATCAAAACCTTTCCC
CGTTAACAAAATGTTGCACTACATAGAAATACAACAATGTCCAGATCGGA
AAAAAAATCATCCATCGCTCGTCAACGTGAAGGCGAGTACAACAATGGTG
AGTGCAAAGAAAATTATGGCGCATGCAAACAACCACAGGCCCTTGCTGGG
GCCTTTGTTTTGGGTTTCTTGACCGCCTAGCTCAACTTCTTTGAGAAGCT
CGGTTACCTTGTCCATGTCCGAGTCTTTAGCGGCTTGGAGTAGTCTACTT
TGGATTTTATCAAGTTTGTTGAGCCGTTTACTCTTGGATGCATCCTTGAG
TGGCCAGATAAAACCTGTCATCTTCCAGAGGAGGATGCCTACGTATATTG
CCACAATGCAGTCATACGAGAGCCGAGCTAAAGCCTCCGTAAGCCTCCGT
CCAAGCCATAGCTGTCAGTACAGCAACAAGCATGTGACCACTGTATATAA
GGTCATTGCAGCCACCACCAGCTTTCTTCAGCAGACTGAACCATGAAGAT
CCTTCTGATGCAGTCGGTCGCAGGAAGTCAATTAAGAAACTCATAGAACC
CCAATCCAGTCGATAGTCACTCGGATAATTACCAACATCAGCATAAGCCA
TATCCCTGATTTATAATCT
back to top