DT214539

Overview
NameDT214539
Unique NameDT214539
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length253
Libraries
Library NameType
Ruby Orange Developing Seed cDNA Library UCRCS09-2cdna_library
Properties
Property NameValue
Genbank descriptionUCRCS09_21E09_b2 Ruby Orange Developing Seed cDNA Library UCRCS09-2 Citrus sinensis cDNA clone UCRCS09-21E09-I18-1-4.d-polyt, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DT214539 ID=DT214539|Name=DT214539|organism=Citrus sinensis|type=EST|length=253bp
TTGCAACAGCATTGATTATGTCCTAGATCCCCTTTAAGAGACTGTAATTT
AGCTAATGGGACTGGCAAATCTATTGCAAGCTAGCACACACTAGAAACCT
AGCTAGCTACATTATATGGTCATTTATCTACAAGCCCACATCCTAAATCA
ACGACGTCAATGATCACTTGATGGATTAATAAGTGTGGAGTAAGAGCCAC
TCGGGAGCAGAAATGTAATTCTGTTGAAGCAAGTAGAGGAGATCCTCGTA
ATC
back to top