DT214537

Overview
NameDT214537
Unique NameDT214537
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length367
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig3863 contig Csv1_Contig3863:114..480. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Ruby Orange Developing Seed cDNA Library UCRCS09-2cdna_library
Properties
Property NameValue
Genbank descriptionUCRCS09_19G01_b2 Ruby Orange Developing Seed cDNA Library UCRCS09-2 Citrus sinensis cDNA clone UCRCS09-19G01-N2-1-5.d-polyt, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DT214537 ID=DT214537|Name=DT214537|organism=Citrus sinensis|type=EST|length=367bp
CCTATACGAATGACGACCCCAAGCCAAGAGGCCAAATCAAGAGCCAACCT
TTATTCGTTGGGGGCAAAATAACTTGTGGCTATAAAATCTCTTATAGGCA
TCTGTTAATGTATTTTATATATTAAAAAAAGAAAAACACATCTCACCCAT
GAATATTAAGAGCTTCCCAAAGCAAATTCTTGGGGACAGGGTTTGTGAGG
TCCCGAGCTTGCAGAGCAGCACCCCTCAGAGTCCTAATGGTCCACACATT
GGCCTCAAAGAAGGACAAACTTCTGAAAGGCATATTGTGCTTCTTGCAAA
GATCCCTCACCACCGTCGAAATCTTCCTCAATTGGCAACTTGGCAACCTT
GGAAACAAATGATGCTC
back to top