DT214502

Overview
NameDT214502
Unique NameDT214502
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length847
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Properties
Property NameValue
Genbank descriptionUCRCS07_3H02_b2 Parent Washington Navel Orange Thrip-Challenged Flavedo cDNA Library UCRCS07-2 Citrus sinensis cDNA clone UCRCS07-3H02-O3-1-7.d-polyt, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DT214502 ID=DT214502|Name=DT214502|organism=Citrus sinensis|type=EST|length=847bp
TAAAGTCCACAAGAAAAGAATCAAGAATACATTAATGTATGGAAGAAAAT
TCACTTATCTGTTCAGAATATTTTCTATAAATCAATTCAATGATGATTTT
GTTGTGGTGGACGCTGAATAAAACTACTGACAGGTTTATCCACCCTACAA
CTAACATCCTGTGAACAATAAGAACTTCTAAGCTCATTTCTCCTCCAAAG
CCAAGGGGGTCCCTTCCTCTTTTGCTGCCTGAAGTATCTCTTTCCCAGAT
CATTAGAGGATCCCCTCATTCTTTTAAACGTGTGTTGTCCGTCTGTGCCC
GGAATGTCTGCATCTGACTGGTTAGCTCCAGTCATGCTTGGATTGTCTTC
ATCTGGACAGCAAGGGGGTGCATGATTGCTATCTTGTTGCCATTCTTCTG
CAGGTCCATCAATGGTTTTACAACTAACAGCAGAGGCAGGTGGAGTGTCT
TTCTTATCACGGGGAAAGGGGGGTAAAGGTGGAAAAGGATGAAAAGGCAT
GCTGGGAGCGATAACCCAACTATCAACAGTTTCAGCCTGGGATGACCCAA
ACTGCTGCAAAATATGCAATGGAATTCCATAAGACACAGGTAGGCGGGAA
TTGAATTTTCCCTGAGGATGTGCAATAGCCACATCAAATGCACATCTCAA
CTGTGAAACATTTTGTTGAGACAGGTCAGTAGTTGATGAAGAATCGGATG
AAACCAGAGGAGGGTTAAACGGAGATGAAAAACCGGGTGGAACATCCTCT
TGTGTGATCTGTCCTCCATCTTCGGAGCTAACAGCTTCATCTTTGTTACA
GTGATTGTGAATATGATCAGGACAATTGATGTCCTCTCTACTCGGTA
back to top