DT214500

Overview
NameDT214500
Unique NameDT214500
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length360
Properties
Property NameValue
Genbank descriptionUCRCS07_21H04_b2 Parent Washington Navel Orange Thrip-Challenged Flavedo cDNA Library UCRCS07-2 Citrus sinensis cDNA clone UCRCS07-21H04-P7-1-5.d-polyt, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DT214500 ID=DT214500|Name=DT214500|organism=Citrus sinensis|type=EST|length=360bp
TCAGAGCATTGTAACACTTGTTATCCTTTGGGGGAGCACTGAAGTTGATG
AGAACATCACAACTTCAGTGATGAAAAAAATTTGAACAGAACCACATAGT
CATCATGTATGCAATCTATGAAATAAATGAGTTTCAGTCATGTATGCAAG
AACCCAAAATGATGGCCTTTCCTTCTTGTTTATTTGTTCTGTGGAAACAT
ATGTATGAGGACCAAAAAGTGCCCCACCCTCCCCTGAAAAACCCTATTCC
AGTTTGGCATTTCAAATTTATGAGAAACTTTAGTTGTGCTTCTCTTGACA
AATCATTTATAAAACCGTGAGTGTGTAACAACAATATTACTGACCCGCTC
TCTTCAAGTA
back to top