DT214499

Overview
NameDT214499
Unique NameDT214499
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length820
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig4723 contig Csv1_Contig4723:432..1252. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS07_20B10_b2 Parent Washington Navel Orange Thrip-Challenged Flavedo cDNA Library UCRCS07-2 Citrus sinensis cDNA clone UCRCS07-20B10-C20-1-5.d-polyt, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DT214499 ID=DT214499|Name=DT214499|organism=Citrus sinensis|type=EST|length=820bp
TTTCATTGAGCTAAAAGTAGAAACTTCTTCCAGTGCACTTACAGGCCCCC
TTTAAGGGTTTCTTTTTTCCCTTTTTTTTTTTCCTCCTTCTTTATACAGA
AACTAAAAACTGTAAACTGAAAAGGCACCGGGTGCTTGACGACCCACAAA
AGAAAAAACTGAAAAAAAAAAAATTTTTAAAAAGCAGAAAGAAAAATGAC
ATAGAAAGTTCTACAGGTGCAAAGAACTGGAAGCAGCTAGCAAGCCAAGA
AGCCGTTGATAACCTGGGAAGGGAAATTGATGGTGATGGTGATGAGTTAG
CTCATTTTTCAACTGTGTGATGTGTGAGTTAGCTCAGTTCTCAACTATCT
CTGGACCGATGTAGAAAGATCCAATAACAAGTAAGTCCTTAGGTTTCTCA
CCCTCTTGAAGCCATGCATGCCCTTCTTTCTCCTCTTCAGGGACTGATGC
TCCATCAACTGAGAAATTGGCAAATGGGAAGTCTTGATAGTACGTGCAGT
GTCGGCCTTCAGAATCGGAGTATGGAGGGCCAAGCACATCCAGCACGGCA
CATGCCGTCACTGCCGTGAAGCAATGCATGTTGCCACCATCATCAGGATA
AAGGATGGAGGTGTTACAAGGGGCTGTAAGATCAGAGTCGGCCTTAACTT
TTGCCAACCGCACTCCAGGCTTCTTGGTTTTTGAAGGATGAGCATCAGTT
GACATTTTCGAAGGGACATCAACCGCATCAGCAGATGTGTTTCCATTGTC
GTTAACCGCATCAGCTGAATTTTTGTCAGGGACGGCATCTACAGCACCAG
CTAATGGCTTGCCAGGGATG
back to top