DT214493

Overview
NameDT214493
Unique NameDT214493
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length458
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2084 contig Csv1_Contig2084:24..481. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionUCRCS07_18C10_b2 Parent Washington Navel Orange Thrip-Challenged Flavedo cDNA Library UCRCS07-2 Citrus sinensis cDNA clone UCRCS07-18C10-F20-1-5.d-polyt, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DT214493 ID=DT214493|Name=DT214493|organism=Citrus sinensis|type=EST|length=458bp
TCTTATTTATTGAATTAAACTGCTGGCAATAGTACAAGTCTTTTATTTTT
TTAGTACAGAAGAGTAACGCTATGCTTATTTATTAAATACTACGTATTTC
ATATATGTCTTTCATGCAAAGTGATATAAAATTGCATTTTGAGGTACCAA
ATCCACACTTTGTTTATGAAATACAAACTCTTGAAAGCATAACATTACTC
AACATAAAGCAACTCGTATTTAGCCAATCAACCAGTCTCATTAAGGTTTC
GCCCGTATTGAGGAACTTCAAGAAAATCAAGATTATCATTTCTTATCTCA
TCAGCAAGAATACTATCCCAATACGGCCAAATATCAACACCCTCCTTCAT
AACAAACATCTCTGACCATTGGTTCTTACCTGCAAAAACAGCTTCCATAT
TCTTCAAATCAGAAAATTAAAGAACTCTTCCTATTAATGCAATGAAAAGC
AAGTAGTT
back to top