DT214492

Overview
NameDT214492
Unique NameDT214492
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length368
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig6522 contig Csv1_Contig6522:1..368. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS07_15F03_b2 Parent Washington Navel Orange Thrip-Challenged Flavedo cDNA Library UCRCS07-2 Citrus sinensis cDNA clone UCRCS07-15F03-K5-1-5.d-polyt, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DT214492 ID=DT214492|Name=DT214492|organism=Citrus sinensis|type=EST|length=368bp
CAAATGTAAGAGCCATTGAATGCATAACGATATCAAAAGCAAAAGATTAC
CCTTCTGCATATCAGATCAAGTCTAACACACTAAACTTAATACACAACAA
AGTAACACTAAACATGGCAAAGTTGATCTTATTAAATCAAATAACAAAAT
GGGAAATGAAAACAGGTCCAAACTTCAATCCTCTTCCAACATGTGACCAC
CATCTTCAGCCACCTGAGAGAAGCAGGAGAGCTGAAGAGATTCAGTGAGA
AGAGGACGCAGCGGAGTGCTGGTGGTGGGTGTGGTGAGAATGAGAAGGAG
AAGGAGCGATGACCCTATGGTAGACTTGTTCGCCAACAAGATAGATTCCA
AAAGCGACGAGAGCGATG
back to top