DT214491

Overview
NameDT214491
Unique NameDT214491
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length157
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionUCRCS07_13H12_b2 Parent Washington Navel Orange Thrip-Challenged Flavedo cDNA Library UCRCS07-2 Citrus sinensis cDNA clone UCRCS07-13H12-P23-1-6.d-plyt, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DT214491 ID=DT214491|Name=DT214491|organism=Citrus sinensis|type=EST|length=157bp
CACGATTGTGCCCAATATCTCTCGCCAGATGAAGACTTCTCTGATCTCGA
TTCTCTTCAATTCTTTTGCCTCCAGGGTTCGGATAAATCTGGAAATCGCA
TTTTCCGCCTCGTTGGAAAGTATTTTCCCGCTCCAGTTGTCGGTGGGGAG
CGATTGA
back to top