DT214490

Overview
NameDT214490
Unique NameDT214490
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length892
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig6521 contig Csv1_Contig6521:1..892. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Ruby Orange Developing Flower cDNA Library UCRCS04-2cdna_library
Properties
Property NameValue
Genbank descriptionUCRCS04_2_025B11_T72 Ruby Orange Developing Flower cDNA Library UCRCS04-2 Citrus sinensis cDNA clone UCRCS04_025_VN_B11_rd, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DT214490 ID=DT214490|Name=DT214490|organism=Citrus sinensis|type=EST|length=892bp
TTTATCACCACTGGGCGTTTCCCCTGAAATCTTGTAAATTTAATATACAC
GTACGGTAATGACCTTATGTCCTCATGAGCACAAGCAAAAACTACACAAC
ATTACCCCCCAGTCCCTAACAAACCACTGAAACAAAAAATGTGTAAAACC
AATAACAGCCTGGTTAAGCAGGCCATGTAAAAATTTTCAACCCACATAAT
CCATAAAATTATGTGGTGCTGATTATCTGTGATTCTGCCGGTATGGTGAA
AAATGAAACCAAACCCTCAAAAGAAAGGTAATGGTACTGAGTTGTATCAT
AATCTAGTGTGTTGCCGATCTTCCATTTGTGGTATCAGTATCATGAGGAT
TAGGATTTCCCTGAGGGGACGGCCCTGAAAACATTTCCATCATTGATCTC
AATGCACCGGTTATGTCCTCAGGCATATTTTCTCCGAAATTTAGATTGAT
ATTACCGCCAATTCTAATTCCAGGCTCATCGAATCCACTCACATTACTAT
CTTCTCCTTGTCTACTTTGAGAAGGCTGTGCCTGAGGCATATTTGAAGCC
ATGTTCATAAGCATGCTTGCGATATCAGTAGGTAAGGCATTAGTGTTGAA
AGGCATTGTAAATGAAGGTGGTGTTCCATGACTTCTGAACCCGCCCGTTG
ACTGGTTTGATTCTTGGCTATAATGACTGGAGCTCGTAGTCTGATCCCAT
CCTGTCCGTTGCCTCTCTTCTCTCAACTTCTGCTCAGCCATCCGAATATT
CTCTTTCACAGCTTCATTATTTGGATCCAATTGCAAGGCTTTCTTAAATC
CTTTTTCAATAGCATCGTTGTAGTTCCCTTGTGCATAATATGCTAAGCCC
AGACGGCTGTATGCCTTGCTATAATTTGGGTCGATATCAATG
back to top