DT214488

Overview
NameDT214488
Unique NameDT214488
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length856
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig3431 contig Csv1_Contig3431:217..1072. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Ruby Orange Developing Flower cDNA Library UCRCS04-2cdna_library
Properties
Property NameValue
Genbank descriptionUCRCS04_2_016E05_T72 Ruby Orange Developing Flower cDNA Library UCRCS04-2 Citrus sinensis cDNA clone UCRCS04_016_VN_E05_rd, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DT214488 ID=DT214488|Name=DT214488|organism=Citrus sinensis|type=EST|length=856bp
TTCTGAACAAGTTGCACAACAATAATTACTAATCCATTTCTCTCTTTCCC
TCTCTAAATTCAACGGACAAATTTTCCTTTCCACTAGGCTAAACTATTGT
AAAGGTTTTCAGATCACAGACCAGGAGAACACTGAAAGACCTGTGATATC
AAGCTTACCAACTTGAAGTTGAACAATCCTAGAACATAGACATATCAGGA
GGTGGTCCATACACGGTCATCCATGAAAATGGGACAATCCATTTCTCACC
ATCATCACCACGGAGGTTGTCAGGATTCAGCCTCAAAAACTTGCATGCTG
CATCAGCCAGATTGAAAGCATCAGCCATATTGTCCCCTTCTGAGCAGTAA
CATAATAAGCATGTAACCTTCAAGCCTCTGGCCTTAAAGCATGAAAATAG
GGCAGCAAAAGGCAAACTTGGGTAGTAATCTTCTTCTTCCAGATCATCCT
CAAAAGTAAAATTATTCTCGTCCCCAACATCTCCTTCAGCTAAAGAGCTA
AGATATTTCCAGCCCCTCTGAGCTGGGTTGTATTCCTGAAGTCTTTTCCA
TCCAAGTTGCTCACAGTAATCATCTGTCCCATCGACACTGGTGCTAGATA
GGTAATATATCTGTGGCCCACTTGACATATCAATTCTTTGCAACCTCCCA
AAGTCTAAGGCAGACAGCACAACCACATGCTTGTTTCCGCTAGCAGCAGC
AAAGTCCGCCAAGTTCTTAGCATATTCAACCATCATCCCCTTAACAACTG
GGGATCTTTGCTGGATAAGAGTCAGCCCACTAGAAGATGACTCATAAGCT
TGAAGAGGAAGAGCAGGGCCGCCACGTGGACTCGGCCGGTAAGCATCGTT
ACCGAC
back to top