CN189356

Overview
NameCN189356
Unique NameCN189356
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length499
Alignments
Feature NameTypeLocationAnalysis
CN189356_ssr461 microsatellite CN189356_ssr461:461..474.
Csv1_Contig6690 contig Csv1_Contig6690:422..920. Citrus sinensis Unigene version 1.0 (Csv1)
Libraries
Library NameType
Washington Navel Orange Stored Fruit Rind cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS06_0001L16_r Washington Navel Orange Stored Fruit Rind cDNA Library Citrus sinensis cDNA clone CS_WEc0001L16, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN189356 ID=CN189356|Name=CN189356|organism=Citrus sinensis|type=EST|length=499bp
TTTTCGCCGTCCATTTAGCATCATATAATCAACTGTTTGTTCCAATCTTT
CACTTTAATCCGAAAATGGCTGGATCCGGTGGAAGTGTTCCTGCTCAGGC
TACTGATTTCTCCTATGAAGGTGACAATAAGAATGTTATCGCCGAGAGCC
TTGAAGTAGTTCCTGAAGTTGCACCAGAGAAAGTGAACGAGGGAGACGAC
AACGGCGGCTGCAAGTGCAACCCATGCAACTGCAACCCGTGTAACTGCAG
CAAATGAGAGACAGATGCGCCATGCGGCCTATGGAATTAATTAACCAGCT
GCCTGTTTAAAAGCATATATATGGATCTTTTTTAAATAAGAACTAATATA
GAATCTAAGACCTATGTTTGCTTCTGCTTCAATGGCTTTCTTGTGAACGT
TTGTAGAATATAGAATAGACTACTGTTTTATGTACGAGTCTCTGCTTTGA
GTTATGTGGTTATATATATATATATGAATAAATGAATAGTATTTTTCTT
back to top