CX286783

Overview
NameCX286783
Unique NameCX286783
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length474
Libraries
Library NameType
Veg1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig14038 contig Ccv1_Contig14038:103..576. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC01001A03Rv Veg1 Citrus clementina cDNA clone C01001A03, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX286783 ID=CX286783|Name=CX286783|organism=Citrus clementina|type=EST|length=474bp
TGTAGCTCCATCTCTCTGCCTCCCAGAGAGAAGCAAAGCATAAAACAAAA
GCTCGTAAATTTGAGCGCTGATTTTCTCCAAAAAGCGATCTCACATCGGC
GTCCGGTTTTACCCTCGAAACCTCAATTCAACCTTCCCGCTTCCGACTCA
CTGAATCAGCCCGTGACGATGTCGTTTATCAGCTTCTAGATCTCCTCCGA
TCAACCCTTTTCATCTCCGAAAGCGCAATTCAACTAATCCTCCTCAAGCT
ATTCAAAATCGCAAATATGGCGTTACGTGTCACCGTCAACTTCTCCGGTT
ACGTCGCTCAAAACCTCGCCCACTCCGCCGGAATCCGCTTCGGCTTCTCC
ACCACCTCCACTCGCTCCTTCCACGAATGCTTGTTTCGCCCTCGAGTCTT
CTGCCACAACAAAAAAACCGACCTTGATCCGGCCCCAAATTATCAGCCCA
AAGCAAATTACCGATGTAACACAC
back to top