CX286792

Overview
NameCX286792
Unique NameCX286792
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length544
Libraries
Library NameType
Veg1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC01001A12Rv Veg1 Citrus clementina cDNA clone C01001A12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX286792 ID=CX286792|Name=CX286792|organism=Citrus clementina|type=EST|length=544bp
AAAAATGCTGTCGTCTTGGCACCGGAATTCACATTTCCGTGCAAGTGGTT
CTCTTCGTTTTAGTCCTTTCGTCACTTTCAGTCCTGGCCGTTCAATTTCA
AGGCCCATCCGAGCTTGTCGACCGTCCGATCAAGATTTCGCTTCTTCTAA
GGGGCTGAATTGGGCAAAACCACTGTTGAAAATCGCCGCCGATAATTTTC
TCCCGCTAGCTCTTATCGGTGGAGTAGCATTTGGATTTGCAAACCCCAGT
CTAGGCTGTCTTGCCGATAAATATCAGTTATCAAAATTTAGCACATTTGC
AATATTTATTGTCTCAGGTTTGACATTGCGTAGTGGAGAAATCGGTGCCG
CTGCAGAAGCATGGCCTGTGGGAATTTTTGGGCTAGTATGACCCTGAATC
TTATGTGCCAATGGGCGTTTTGTAGGTTCATTCTCTGCAGACGTATTTTT
TGTGGATTCATTTCCAATTTCTTTTTCTCCCACATACTGTTTTTTGGGTT
TGAATTTTTGGTTGGTTATGCAAACTGATTCTCATTCTGTCATA
back to top