CX286796

Overview
NameCX286796
Unique NameCX286796
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length562
Libraries
Library NameType
Veg1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig710 contig Ccv1_Contig710:330..891. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC01001B05Rv Veg1 Citrus clementina cDNA clone C01001B05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX286796 ID=CX286796|Name=CX286796|organism=Citrus clementina|type=EST|length=562bp
TTTTTCTTTAAAATTCGTATTTTACTTTCTGTTGGTAAAAACTTAGGATT
ACTTATATGCTTTCATATACATTGACACGAAATGTACACACCACGACCCA
ATCACCATCTCAGACATGAGTAGTGATTTCAACTATATACCAGTATTGTA
CAACATTCTCGTAGACTAACGCCGCATTTCTCTTCCTAACCTCTACTTTT
CTCGAGCCTCTGACCTTGTTCCGTTTTTGGGGAAATTTAAGGTGAGGTGT
GAATGTGGAACTTCCGCACACAAGGCATCAGACTGGAACAGGACTTTGTT
CCAGACTCTCCTTCCCTGTAATGCCATCCTTCAACCCTTTGAAATATATG
TTGTAGTCCTTCTCTTGGGGTGGGTTCTCTGGGTCAACTGTAAATGATTC
ACTAAATGGAATAGTACTCTTAACCTCAAATGTTTTGTCAAGTGCAAATG
GACTTTCCAAGGCAGCAACACATACCCGAGCAACCTCTTCCCCTCGTGCC
GAATTCGGCACGAGGGTTCCATTCTACTCAGCAGAGAAAGAGATCAACAA
CAGAGCAAACAA
back to top