CX286799

Overview
NameCX286799
Unique NameCX286799
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length150
Libraries
Library NameType
Veg1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig2 contig Ccv1_Contig2:1..150. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC01001B08Rv Veg1 Citrus clementina cDNA clone C01001B08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX286799 ID=CX286799|Name=CX286799|organism=Citrus clementina|type=EST|length=150bp
GATATTCAACTTCAATAATATTCTTAGAAACATGGCTGACGTGAAGCTTT
ATGGGGGATTGCTGAGTCCATCTAATTACAGGGTGGTGTGCGCTCTGAAA
TTGATAGGCATACCTTTTGAATTGATTAACGAAGATCTCTCATACAAAGG
back to top