CX286939

Overview
NameCX286939
Unique NameCX286939
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length388
Libraries
Library NameType
Veg1cdna_library
Properties
Property NameValue
Genbank descriptionC01002G08Rv Veg1 Citrus clementina cDNA clone C01002G08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX286939 ID=CX286939|Name=CX286939|organism=Citrus clementina|type=EST|length=388bp
AATGCACAAGCACAACCCGCCCTTTATCTCCTACCAATGTTTTCCGACTC
TGCTGCCTCTTCCATGTGCAAAATCAAACACAGATTCAAATACCTTAGCC
CTAGTTGTCTTTTAGCTTTCCATGTCATTCTTGGATTTTTTTATTCTTGG
GATTTTCACTCATTGCACTCAAAGAGAGGAAGAAAAAAAAAAATTGAATT
TGTGAAGAAAGTTGCGGCTGTCAAGCATATCAAGATTCATATGAAGATCC
AGGGGGAAAAAAGATTTTTAGATCACTTAATTAGCTTAATTTCTTCTCTC
AATTGAGCTTGACTTCAATTTCATTTGCTTACTACTGTTGAGTTAAGATC
GGTTGCCAATCTAGATTACAGGGGGGAGATTTTTGAAT
back to top