CX286940

Overview
NameCX286940
Unique NameCX286940
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length304
Libraries
Library NameType
Veg1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig69 contig Ccv1_Contig69:1560..1863. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC01002G09Rv Veg1 Citrus clementina cDNA clone C01002G09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX286940 ID=CX286940|Name=CX286940|organism=Citrus clementina|type=EST|length=304bp
TTTTTTTTTTTTTTTTTTTTTTTTTATTTTTTTTATTTTTTTTTTTTTTT
TTTTTTGGCCCAAACAAAAGAAACATTTATTTATGATAAATTAACCCACT
GATTTCCAAGGGGCATTCATTACAAGATCAAGTACCATTAAGGGTAAAAA
AATGAAAAAAAAACTGGCCCCTATAATCAAATCCTGGCTAAGGGGAGAAA
AAAATGGTTAGAATTTAAATAACCATAATAATCATGGTCAAATTTCACAA
GCCTAGAGAATTTGGGGGTTCAAATTGTACAAGATTGAAAATCCCCAAAT
TTCA
back to top